ABSTRACT
Objective
Materials and Methods
Results and Discussion
Implications and Applications
Key words
INTRODUCTION
- García-Ruiz A.
- Cole J.B.
- VanRaden P.M.
- Wiggans G.R.
- Ruiz-Lopez F.J.
- Van Tassell C.P.
- Wiltbank M.C.
- Baez G.M.
- Garcia-Guerra A.
- Toledo M.Z.
- Monteiro P.L.
- Melo L.F.
- Ochoa J.C.
- Santos J.E.
- Sartori R.
- Oliveira J.F.
- Henkes L.E.
- Ashley R.L.
- Purcell S.H.
- Smirnova N.P.
- Veeramachaneni D.N.
- Anthony R.V.
- Hansen T.R.
- Moore S.G.
- Pryce J.E.
- Hayes B.J.
- Chamberlain A.J.
- Kemper K.E.
- Berry D.P.
- McCabe M.
- Cormican P.
- Lonergan P.
- Fair T.
- Butler S.T.
MATERIALS AND METHODS
Animal Care and Sorting of Lactating Dairy Cows into High- and Low-Fertility Groups
Trait | Fertility classification | ||
---|---|---|---|
NP | LP | HP | |
Number of cows | 7 | 6 | 7 |
DGV-DPR | −1.50 ± 0.06a | −2.31 ± 0.17b | −1.10 ± 0.18a |
gPTA-DPR | 0.22 ± 0.70a | −0.61 ± 0.35a | −0.09 ± 0.64a |
gPTA-DPR reliability | 36.57 ± 0.81a | 34.43 ± 2.59a | 34.83 ± 1.87a |
SPC | 1.29 ± 0.18a | −3.71 ± 0.42b | 1.43 ± 0.20a |
gPTA-milk | 1,627.90 ± 371.11a | 1,185.14 ± 376.89a | 1,782.20 ± 328.88a |
gPTA-milk reliability | 62.14 ± 0.99a | 61.86 ± 1.40a | 63.00 ± 0.63a |
DIM | 18.00 ± 3.00a | 16.00 ± 2.77a | 15.00 ± 2.16a |
Number of lactations | 2.43 ± 0.20a | 2.71 ± 0.18a | 2.43 ± 0.20a |
Julian calving date | 223.00 ± 3.00a | 225.00 ± 2.77a | 226.00 ± 2.16a |
Estrous Synchronization, Timed AI, and Conceptus Flush
- Pursley J.R.
- Wiltbank M.C.
- Stevenson J.S.
- Ottobre J.S.
- Garverick H.A.
- Anderson L.L.
Collection of Endometrium, Serum, and Peripheral Blood Mononuclear Cells
RNA, DNA, and Protein Extraction
Western Blot
Semiquantitative RT-qPCR and Primers for ISG15
Target | Accession no. | Primer sequence | ||
---|---|---|---|---|
ISG15 | NM_174366 | F: ggtatccgagctgaagcagtt R: acctccctgctgtcaaggt | ||
GAPDH | NM_001034034 | F: tgaccccttcattgaccttc R: cgttctctgccttgactgtg | ||
18s ribosomal RNA | NR_036642 | F: gaacgagactctgggcatgc R: ctgaacgccacttgtccctc |
Progesterone and Estradiol Radioimmunoassay
Statistics
Graves, S., H. P. Piepho, and L. Selzer. 2015. MultcompView: Visualizations of Paired Comparisons. Accessed Jan. 1, 2016. https://CRAN.R-project.org/package=multcompView.
RESULTS AND DISCUSSION
Relationship Between gPTA-DPR, SPC, and Fertility Classifications
- Berry D.P.
- Bastiaansen J.W.
- Veerkamp R.F.
- Wijga S.
- Wall E.
- Berglund B.
- Calus M.P.

Conceptus Classification



IFNT in Conceptuses and UF
- Anthony R.V.
- Helmer S.D.
- Sharif S.F.
- Roberts R.M.
- Hansen P.J.
- Thatcher W.W.
- Bazer F.W.
- Imakawa K.
- Hansen T.R.
- Malathy P.V.
- Anthony R.V.
- Polites H.G.
- Marotti K.R.
- Roberts R.M.
- Gobikrushanth M.
- MacMillan K.
- Hipkin D.
- Colazo M.G.
- Wiltbank M.C.
- Baez G.M.
- Garcia-Guerra A.
- Toledo M.Z.
- Monteiro P.L.
- Melo L.F.
- Ochoa J.C.
- Santos J.E.
- Sartori R.
Effect of IFNT on ISG15 Expression in Endometrium and PBMC


- Antoniazzi A.Q.
- Webb B.T.
- Romero J.J.
- Ashley R.L.
- Smirnova N.P.
- Henkes L.E.
- Bott R.C.
- Oliveira J.F.
- Niswender G.D.
- Bazer F.W.
- Hansen T.R.
- Pugliesi G.
- Miagawa B.T.
- Paiva Y.N.
- Franca M.R.
- Silva L.A.
- Binelli M.
- Oliveira J.F.
- Henkes L.E.
- Ashley R.L.
- Purcell S.H.
- Smirnova N.P.
- Veeramachaneni D.N.
- Anthony R.V.
- Hansen T.R.
- Bott R.C.
- Ashley R.L.
- Henkes L.E.
- Antoniazzi A.Q.
- Bruemmer J.E.
- Niswender G.D.
- Bazer F.W.
- Spencer T.E.
- Smirnova N.P.
- Anthony R.V.
- Hansen T.R.
- Antoniazzi A.Q.
- Webb B.T.
- Romero J.J.
- Ashley R.L.
- Smirnova N.P.
- Henkes L.E.
- Bott R.C.
- Oliveira J.F.
- Niswender G.D.
- Bazer F.W.
- Hansen T.R.
- Pugliesi G.
- Miagawa B.T.
- Paiva Y.N.
- Franca M.R.
- Silva L.A.
- Binelli M.
Serum P4 and Estradiol Concentrations
- Shorten P.R.
- Ledgard A.M.
- Donnison M.
- Pfeffer P.L.
- McDonald R.M.
- Berg D.K.
- Plante C.
- Thatcher W.W.
- Hansen P.J.
APPLICATIONS
ACKNOWLEDGMENTS
LITERATURE CITED
- Association of lipid-related genes implicated in conceptus elongation with female fertility traits in dairy cattle..https://doi.org/10.3168/jds.2019-1706831477299J. Dairy Sci. 2019; 102: 10020-10029
- The cross-species antiviral activities of different IFN-tau subtypes on bovine, murine, and human cells: contradictory evidence for therapeutic potential..https://doi.org/10.1089/10799909931279510638702J. Interferon Cytokine Res. 1999; 19: 1335-1341
- Synthesis and processing of ovine trophoblast protein-1 and bovine trophoblast protein-1, conceptus secretory proteins involved in the maternal recognition of pregnancy..https://doi.org/10.1210/endo-123-3-12742456911Endocrinology. 1988; 123: 1274-1280
- Endocrine delivery of interferon tau protects the corpus luteum from prostaglandin F2 alpha-induced luteolysis in ewes..https://doi.org/10.1095/biolreprod.112.10568423616594Biol. Reprod. 2013; 88: 144-155
- Deletion of the Isg15 gene results in up-regulation of decidual cell survival genes and down-regulation of adhesion genes: Implication for regulation by IL-1beta..https://doi.org/10.1210/en.2010-016620660068Endocrinology. 2010; 151: 4527-4536
- Localization of ISG15 and conjugated proteins in bovine endometrium using immunohistochemistry and electron microscopy..https://doi.org/10.1210/en.2003-108714563704Endocrinology. 2004; 145: 967-975
- Ubiquitin cross-reactive protein is released by the bovine uterus in response to interferon during early pregnancy..https://doi.org/10.1095/biolreprod54.3.6008835381Biol. Reprod. 1996; 54: 600-606
- Interferons and progesterone for establishment and maintenance of pregnancy: Interactions among novel cell signaling pathways..https://doi.org/10.1016/S1642-431X(12)60012-619092983Reprod. Biol. 2008; 8: 179-211
- Embryo loss in cattle between days 7 and 16 of pregnancy..https://doi.org/10.1016/j.theriogenology.2009.09.00519880168Theriogenology. 2010; 73: 250-260
- Genome-wide associations for fertility traits in Holstein-Friesian dairy cows using data from experimental research herds in four European countries..https://doi.org/10.1017/S175173111200006723217223Animal. 2012; 6: 1206-1215
- Uterine vein infusion of interferon tau (IFNT) extends luteal life span in ewes..https://doi.org/10.1095/biolreprod.109.07946720042537Biol. Reprod. 2010; 82: 725-735
- Associations between genomic merit for daughter pregnancy rate of Holstein cows and metabolites postpartum and estrus characteristics..https://doi.org/10.3168/jds.2020-1820732921462J. Dairy Sci. 2020; 103: 10754-10768
- Embryo survival in dairy cows managed under pastoral conditions..https://doi.org/10.1016/j.anireprosci.2006.08.00816963203Anim. Reprod. Sci. 2006; 96: 297-311
- The evolution of interferon-tau..10.1530/REP-17-0292Reprod. Anniv. Rev. 2017; 154: F1-F10
- Non-surgical recovery of bovine eggs..https://doi.org/10.1016/0093-691X(76)90120-51027650Theriogenology. 1976; 6: 523-532
- Radioimmunoassay of estradiol-17-beta without chromatography..https://doi.org/10.1210/jcem-38-1-424809641J. Clin. Endocrinol. Metab. 1974; 38: 42-50
- Changes in genetic selection differentials and generation intervals in US Holstein dairy cattle as a result of genomic selection..https://doi.org/10.1073/pnas.151906111327354521Proc. Natl. Acad. Sci. USA. 2016; 113: E3995-E4004
- Regulation of interferon-stimulated genes in peripheral blood leukocytes in pregnant and bred, nonpregnant dairy cows..https://doi.org/10.3168/jds.S0022-0302(07)72628-017183095J. Dairy Sci. 2007; 90: 274-280
- The relationships among sire’s predicted transmitting ability for daughter pregnancy rate and cow conception rate and daughter’s reproductive performance in Canadian Holstein cows..https://doi.org/10.1016/j.theriogenology.2020.03.02632259748Theriogenology. 2020; 149: 117-122
Graves, S., H. P. Piepho, and L. Selzer. 2015. MultcompView: Visualizations of Paired Comparisons. Accessed Jan. 1, 2016. https://CRAN.R-project.org/package=multcompView.
- Measurement of interferon-tau (IFN-tau) stimulated gene expression in blood leukocytes for pregnancy diagnosis within 18–20d after insemination in dairy cattle..https://doi.org/10.1016/j.anireprosci.2010.05.01020554404Anim. Reprod. Sci. 2010; 121: 24-33
- Low blood ISG15 mRNA and progesterone levels are predictive of non-pregnant dairy cows..https://doi.org/10.1677/joe.1.0701517088421J. Endocrinol. 2006; 191: 505-512
- Mechanism of action of interferon-tau in the uterus during early pregnancy..10692865J. Reprod. Fertil. Suppl. 1999; 54: 329-339
- Endocrine actions of interferon-tau in ruminants..21755682Soc. Reprod. Fertil. Suppl. 2010; 67: 325-340
- The genes for the trophoblast interferons and the related interferon-alpha II possess distinct 5′-promoter and 3′-flanking sequences..https://doi.org/10.1016/S0021-9258(18)49954-11704373J. Biol. Chem. 1991; 266: 3060-3067
- ISGylation: A conserved pathway in mammalian pregnancy..https://doi.org/10.1007/978-1-4939-0817-2_225030758Adv. Exp. Med. Biol. 2014; 759: 13-31
- Molecular cloning and characterization of complementary deoxyribonucleic acids corresponding to bovine trophoblast protein-1: A comparison with ovine trophoblast protein-1 and bovine interferon-alpha II..https://doi.org/10.1210/mend-3-1-1272521687Mol. Endocrinol. 1989; 3: 127-139
- Pregnancy and interferon-tau induce conjugation of bovine ubiquitin cross-reactive protein to cytosolic uterine proteins..https://doi.org/10.1095/biolreprod58.4.8989546718Biol. Reprod. 1998; 58: 898-904
- Least-Squares Means: The R Package lsmeans..https://doi.org/10.18637/jss.v069.i01J. Stat. Softw. 2016; 69: 1-33
- Early genomic prediction of daughter pregnancy rate is associated with improved reproductive performance in Holstein dairy cows..https://doi.org/10.3168/jds.2019-1748832089311J. Dairy Sci. 2020; 103: 3312-3324
- Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT.https://doi.org/10.1006/meth.2001.126211846609Methods. 2001; 25: 402-408
- Maternal-embryo interaction leading up to the initiation of implantation of pregnancy in cattle..https://doi.org/10.1017/S175173111400047024679216Animal. 2014; 8: 64-69
- Role of progesterone in embryo development in cattle..https://doi.org/10.1071/RD1532627062875Reprod. Fertil. Dev. 2016; 28: 66-74
- Symposium review: genetics, genome-wide association study, and genetic improvement of dairy fertility traits..https://doi.org/10.3168/jds.2018-1526930268602J. Dairy Sci. 2019; 102: 3735-3743
- Differentially expressed genes in endometrium and corpus luteum of Holstein cows selected for high and low fertility are enriched for sequence variants associated with fertility..https://doi.org/10.1095/biolreprod.115.13295126607721Biol. Reprod. 2016; 94: 1-11
- Analysis of the uterine lumen in fertility-classified heifers: II. Proteins and metabolites..https://doi.org/10.1093/biolre/ioz19731616912Biol. Reprod. 2020; 102 (a): 571-587
- Uterine influences on conceptus development in fertility-classified animals..https://doi.org/10.1073/pnas.172119111529432175Proc. Natl. Acad. Sci. USA. 2018; 115: E1749-E1758
- Analysis of the uterine lumen in fertility-classified heifers: I. Glucose, prostaglandins, and lipids..https://doi.org/10.1093/biolre/ioz19131616913Biol. Reprod. 2020; 102 (b): 456-474
- Influence of the site of conjugation on the specificity of antibodies to progesterone..https://doi.org/10.1016/0039-128X(73)90104-94747445Steroids. 1973; 22: 413-424
- Reproductive status of Holstein and Jersey cows in the United States..https://doi.org/10.3168/jds.2008-176819528630J. Dairy Sci. 2009; 92: 3517-3528
- Expression of interferon (IFN)-stimulated genes in extrauterine tissues during early pregnancy in sheep is the consequence of endocrine IFN-tau release from the uterine vein..https://doi.org/10.1210/en.2007-086318063687Endocrinology. 2008; 149: 1252-1259
- Alteration of oestrous cycle length, ovarian function and oxytocin-induced release of prostaglandin F-2α by intrauterine and intramuscular administration of recombinant bovine interferon-α to cows..https://doi.org/10.1530/jrf.0.09303751787457Reproduction. 1991; 93: 375-384
- Conceptus-induced changes in the gene expression of blood immune cells and the ultrasound-accessed luteal function in beef cattle: how early can we detect pregnancy?.https://doi.org/10.1095/biolreprod.114.12152525210129Biol. Reprod. 2014; 91: 1-12
- Pregnancy rates per artificial insemination for cows and heifers inseminated at a synchronized ovulation or synchronized estrus..https://doi.org/10.3168/jds.S0022-0302(97)75937-X9058270J. Dairy Sci. 1997; 80: 295-300
- Low peripheral progesterone and late embryonic/early fetal loss in suckled beef and lactating dairy cows..https://doi.org/10.1016/j.theriogenology.2008.07.03118809207Theriogenology. 2009; 71: 480-490
- The polypeptides and genes for ovine and bovine trophoblast protein-1..1843349J. Reprod. Fertil. Suppl. 1991; 43: 3-12
- A single cannula technique for nonsurgical collection of ova from cattle..https://doi.org/10.1016/0093-691X(76)90114-X1036173Theriogenology. 1976; 6: 471-483
- A mathematical model of the interaction between bovine blastocyst developmental stage and progesterone-stimulated uterine factors on differential embryonic development observed on day 15 of gestation..https://doi.org/10.3168/jds.2017-1284529103729J. Dairy Sci. 2018; 101: 736-751
- Implantation and establishment of pregnancy in ruminants..https://doi.org/10.1007/978-3-319-15856-3_726450497Adv. Anat. Embryol. Cell Biol. 2015; 216: 105-135
Team, R. C. 2015. R: A Language and Environment for Statistical Computing. 3.2.3 ed. R Found. Stat. Comp.
- Prospects for improving reproductive performance through genetic selection..https://doi.org/10.1016/j.anireprosci.2006.08.01016962265Anim. Reprod. Sci. 2006; 96: 323-330
- Pivotal periods for pregnancy loss during the first trimester of gestation in lactating dairy cows..https://doi.org/10.1016/j.theriogenology.2016.04.03727238438Theriogenology. 2016; 86: 239-253
- Physiological and practical effects of progesterone on reproduction in dairy cattle..https://doi.org/10.1017/S175173111400058524703103Animal. 2014; 8: 70-81
Article info
Publication history
Footnotes
The authors have not declared any conflicts of interest.